The present Chairman of the Cauvery Water Dispute Tribunal is— Answer : Justice N. P. Singh...
‘Ramadorai Sujatha’ who was recently in news is a— Answer : Mathematician...
Julictte Binoche has begged best actress award in 63rd International Film Festival of Cannes for the film— Answer : Certified Copy...
The first Indian to win Nobel Prize was— Answer : Rabindra Nath Tagore...
Where is the biggest desert on earth? a. Siberia c. Africa b. Antarctica d. California Answer : b. Reykjavik, Iceland...
Genes which are active all the time synthesizing substances needed by the cell are called a) Cellular luxury genes b) metabolic genes c) house keeping genes d) control genes Answer : c) house keeping genes...
If the sequence of bases in DNA is TACCGACCA, then the sequence of codons on the transcript will be a) ATGGCTGGT b) ATCCGAACU c) AUGGCUGGU d) AUGGACUAA Answer : c) AUGGCUGGU...
The structural genes of lac operon transcribe mRNA which is a) polycistronic b) replicative c) monokaryotic d) monocistronic Answer : a) polycistronic...
The stretch of codons between AUG and a stop codon is called a) open reading frame b) TATA box c) colinearity d) degenerate Answer : a) open reading frame...
The transcription initiation factor associated with the RNA polymerase holoenzyme in prokaryotes is (a) β (b) ω (c) σ (d) αI Answer : c) σ (...
Which of the statements give below is correct with respect to frameshift mutation a) a single nucleotide base change, insertion, or deletion of the genetic material b) Glutamine is replaced by valine c) ... or deletions of a number of nucleotides in a DNA sequence that is not divisible by three. Answer : d) insertions or deletions of a number of nucleotides in a DNA sequence that is not divisible by three....
Enzyme which can break and seal the DNA strand a) Topoisomease II (b) Helicase (c) Primase (d) Restriction endonuclease Answer : a) Topoisomease II...
The percentage of human genome which encodes proteins is approximately a) Less than 2% b) 5% c) 25% d) 99% Answer : a) Less than...
Select the incorrect statement out of the five given below about lac operon when Lactose is present in the medium. a) Gene - A gets transcribed into mRNA which produces β-galactoside permease b) ... polymerase transcribe Z-gene, Y-gene and A-gene e) Allolactose is the inducer of lac operon Answer : Gene – A gets transcribed into mRNA which produces β-galactoside permease b) Inducer-Repressor complex is formed...
hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA...
Peptidyl transferase a) Is a 23s rRNA b) forms peptide bonds c) component of ribosome d) all the three Answer : d) all the three...
Wobble position means a) Base paring b) altered base on code b) third altered base on codon d) none of the above Answer : b) third altered base on codon...
Sickle cell anemia is caused a) When valine is replaced by glutamic acid in beta polypeptide chain b) When glutamic acid is replaced by valine in beta polypeptide chain c) When ... valine in alpha polypeptide chain d) When valine is replaced by glutamic acid in alpha polypeptide chain Answer : b) When glutamic acid is replaced by valine in beta polypeptide chain...
The removal of which enzyme affects the synthesis of hnRNA in eukaryotes a) RNA polymerase II b) RNA primase c) RNA polymerase III d) RNA polymerase I Answer : a) RNA polymerase II...
The coding sequences found in split genes are called a) Operons b) introns c) exons d) cistrons Answer : c) exons...
50.5k questions
47.1k answers
240 comments
7.0k users
