Recent activity

by ayush dekate answered Aug 1, 2021 2 views

Genes which are active all the time synthesizing substances needed by the cell are called a) Cellular luxury genes b) metabolic genes c) house keeping genes d) control genes
Answer : c) house keeping genes...

by ayush dekate answered Aug 1, 2021 1 view

If the sequence of bases in DNA is TACCGACCA, then the sequence of codons on the transcript will be a) ATGGCTGGT b) ATCCGAACU c) AUGGCUGGU d) AUGGACUAA
Answer : c) AUGGCUGGU...

by ayush dekate answered Aug 1, 2021 3 views

The structural genes of lac operon transcribe mRNA which is a) polycistronic b) replicative c) monokaryotic d) monocistronic
Answer : a) polycistronic...

by ayush dekate answered Aug 1, 2021 2 views

The stretch of codons between AUG and a stop codon is called a) open reading frame b) TATA box c) colinearity d) degenerate
Answer : a) open reading frame...

by ayush dekate answered Aug 1, 2021 3 views

The transcription initiation factor associated with the RNA polymerase holoenzyme in prokaryotes is (a) β (b) ω (c) σ (d) αI
Answer : c) σ (...

by ayush dekate answered Aug 1, 2021 3 views

Which of the statements give below is correct with respect to frameshift mutation a) a single nucleotide base change, insertion, or deletion of the genetic material b) Glutamine is replaced by valine c) ... or deletions of a number of nucleotides in a DNA sequence that is not divisible by three.
Answer : d) insertions or deletions of a number of nucleotides in a DNA sequence that is not divisible by three....

by ayush dekate answered Aug 1, 2021 0 views

Enzyme which can break and seal the DNA strand a) Topoisomease II (b) Helicase (c) Primase (d) Restriction endonuclease
Answer : a) Topoisomease II...

by ayush dekate answered Aug 1, 2021 2 views

The percentage of human genome which encodes proteins is approximately a) Less than 2% b) 5% c) 25% d) 99%
Answer : a) Less than...

by ayush dekate answered Aug 1, 2021 1 view

Select the incorrect statement out of the five given below about lac operon when Lactose is present in the medium. a) Gene - A gets transcribed into mRNA which produces β-galactoside permease b) ... polymerase transcribe Z-gene, Y-gene and A-gene e) Allolactose is the inducer of lac operon
Answer : Gene – A gets transcribed into mRNA which produces β-galactoside permease b) Inducer-Repressor complex is formed...

by ayush dekate answered Aug 1, 2021 2 views

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA...

by ayush dekate answered Aug 1, 2021 4 views

Peptidyl transferase a) Is a 23s rRNA b) forms peptide bonds c) component of ribosome d) all the three
Answer : d) all the three...

by ayush dekate answered Aug 1, 2021 2 views

Wobble position means a) Base paring b) altered base on code b) third altered base on codon d) none of the above
Answer : b) third altered base on codon...

by ayush dekate answered Aug 1, 2021 3 views

Sickle cell anemia is caused a) When valine is replaced by glutamic acid in beta polypeptide chain b) When glutamic acid is replaced by valine in beta polypeptide chain c) When ... valine in alpha polypeptide chain d) When valine is replaced by glutamic acid in alpha polypeptide chain
Answer : b) When glutamic acid is replaced by valine in beta polypeptide chain...

by ayush dekate answered Aug 1, 2021 1 view

The removal of which enzyme affects the synthesis of hnRNA in eukaryotes a) RNA polymerase II b) RNA primase c) RNA polymerase III d) RNA polymerase I
Answer : a) RNA polymerase II...

by ayush dekate answered Aug 1, 2021 2 views

The coding sequences found in split genes are called a) Operons b) introns c) exons d) cistrons
Answer : c) exons...

by ayush dekate answered Aug 1, 2021 0 views

Read the statements given below and identify the incorrect statement. a) The human genome contains 3164.7 million nucleotide bases. b) The average gene consists of 30,000 bp c) The total number of genes is ... . d) Chromosome Y has 231 genes e) Less than 2% of the genome codes for proteins.
Answer : d) Chromosome Y has 231 genes...

by ayush dekate answered Aug 1, 2021 1 view

Cistron is a) The coding sequence of DNA b) The functional unit of DNA molecule that codes for a particular gene product c) Intervening non coding sequence of DNA d) The sequences which are removed during RNA splicing.
Answer : b) The functional unit of DNA molecule that codes for a particular gene product c) Intervening non coding sequence of DNA...

by ayush dekate answered Aug 1, 2021 2 views

Teminism is a) a central dogma reverse b) a central dogma of molecular biology c) a circular flow of hereditary material d) an effect of cytoplasm on functioning of DNA
Answer : a) a central dogma reverse...

by ayush dekate answered Aug 1, 2021 2 views

A bacterial colony containing DNA made up of 100% N15 nitrogen bases is allowed to replicate in a medium containing N14 bases. After one round of replication the result would be a) All individuals ... Only 50% individuals would be hybrids d) All individuals would have DNA made up of 100% N14
Answer : b) All individuals will be hybrids...

by ayush dekate answered Aug 1, 2021 2 views

Hershey and Chase experiment proving DNA as the genetic material was based on the principle a) Transduction b) transformation c) transcription d) translation
Answer : a) Transduction...