🔍
hich mRNA will be translated to a polypeptide chain containing 8 amino acids?  a) AUGUUAAUAGACGAGUAGCGACGAUGU  
b) AUGAGACGGACUGCAUUCCCAACCUGA
c) AUGCCCAACCGUUAUUCAUGCUAG
d) AUGUCGACAGUCUAAAACAGCGGG
0 like 0 dislike

1 Answer

b) AUGAGACGGACUGCAUUCCCAACCUGA
0 like 0 dislike

Related questions

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (1) Polysome (2) Polyhedral bodies (3) Plastidome (4) Nucleosome
Answer : (1) Polysome...

View solution
0 like 0 dislike
1 answer

If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered ? (1) 11 (2) 33 (3) 333 (4) 1
Answer : (2) 33...

View solution
0 like 0 dislike
1 answer

All the following are sulphur containing amino acids found in proteins except (A) Cysteine (B) Cystine (C) Methionine (D) Threonine
Answer : (D) Threonine...

View solution
0 like 0 dislike
1 answer

Sickle cell anemia is caused a) When valine is replaced by glutamic acid in beta polypeptide chain b) When glutamic acid is replaced by valine in beta polypeptide chain c) When ... valine in alpha polypeptide chain d) When valine is replaced by glutamic acid in alpha polypeptide chain
Answer : b) When glutamic acid is replaced by valine in beta polypeptide chain...

View solution
0 like 0 dislike
1 answer

Amino acid with side chain containing basic groups is (A) 2-Amino 5-guanidovaleric acid (B) 2-Pyrrolidine carboxylic acid (C) 2-Amino 3-mercaptopropanoic acid (D) 2-Amino propanoic acid
Answer : (A) 2-Amino 5-guanidovaleric acid...

View solution
0 like 0 dislike
1 answer

50.5k questions

47.1k answers

240 comments

7.0k users